ID: 1142888900_1142888919

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1142888900 1142888919
Species Human (GRCh38) Human (GRCh38)
Location 17:2930241-2930263 17:2930281-2930303
Sequence CCCCTTGTGGCCAATACCATCAG TGGCTGGGGCTGGGGGTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83} {0: 1, 1: 2, 2: 23, 3: 264, 4: 1820}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!