ID: 1142909251_1142909255

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1142909251 1142909255
Species Human (GRCh38) Human (GRCh38)
Location 17:3072947-3072969 17:3072977-3072999
Sequence CCCAGCTGTAGGACTTTGAGTTG AGTCCCCCAGAGCCACCATGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 16, 4: 148} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!