ID: 1143904563_1143904569

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1143904563 1143904569
Species Human (GRCh38) Human (GRCh38)
Location 17:10198559-10198581 17:10198597-10198619
Sequence CCGCGCCGGGAAGCAGAGACTCG GAGCGGCGACGCCCCCGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 76} {0: 1, 1: 0, 2: 1, 3: 19, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!