ID: 1144140522_1144140528

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1144140522 1144140528
Species Human (GRCh38) Human (GRCh38)
Location 17:12342808-12342830 17:12342834-12342856
Sequence CCCTCCAGCAGGGGGCAGTAGGA TCTAGCTTTTGCTAATCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!