ID: 1144473251_1144473256

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1144473251 1144473256
Species Human (GRCh38) Human (GRCh38)
Location 17:15563117-15563139 17:15563134-15563156
Sequence CCGCAGGCCGCTCCTCCTCAACT TCAACTCCACCCCGGCAATAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 24, 4: 278} {0: 2, 1: 0, 2: 0, 3: 2, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!