ID: 1144483355_1144483363

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1144483355 1144483363
Species Human (GRCh38) Human (GRCh38)
Location 17:15645403-15645425 17:15645434-15645456
Sequence CCCAAAAACCTCAGGTTTGCCTG CCAGCTTCAATCTTGCCTCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 12, 4: 159} {0: 2, 1: 0, 2: 2, 3: 17, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!