ID: 1144483355_1144483364

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1144483355 1144483364
Species Human (GRCh38) Human (GRCh38)
Location 17:15645403-15645425 17:15645435-15645457
Sequence CCCAAAAACCTCAGGTTTGCCTG CAGCTTCAATCTTGCCTCCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 12, 4: 159} {0: 2, 1: 0, 2: 5, 3: 41, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!