ID: 1145017256_1145017265

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1145017256 1145017265
Species Human (GRCh38) Human (GRCh38)
Location 17:19407560-19407582 17:19407586-19407608
Sequence CCATAGACATGGACCCAGGACCA CACCTGGCCTCCCTGGGCCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 18, 3: 73, 4: 540}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!