ID: 1145190796_1145190809

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1145190796 1145190809
Species Human (GRCh38) Human (GRCh38)
Location 17:20841470-20841492 17:20841519-20841541
Sequence CCGAGAGGAACCTCTATGCCGAC CACCAGGTGAGGGCGACCCTGGG
Strand - +
Off-target summary {0: 5, 1: 1, 2: 6, 3: 9, 4: 55} {0: 5, 1: 6, 2: 2, 3: 15, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!