ID: 1145190811_1145190817

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1145190811 1145190817
Species Human (GRCh38) Human (GRCh38)
Location 17:20841521-20841543 17:20841548-20841570
Sequence CCAGGTGAGGGCGACCCTGGGGG TCAGCCTGGGCACACCCAAGAGG
Strand - +
Off-target summary {0: 5, 1: 3, 2: 6, 3: 24, 4: 238} {0: 6, 1: 4, 2: 2, 3: 10, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!