ID: 1145190811_1145190827

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1145190811 1145190827
Species Human (GRCh38) Human (GRCh38)
Location 17:20841521-20841543 17:20841563-20841585
Sequence CCAGGTGAGGGCGACCCTGGGGG CCAAGAGGGGACCAGGCCGGGGG
Strand - +
Off-target summary {0: 5, 1: 3, 2: 6, 3: 24, 4: 238} {0: 2, 1: 8, 2: 1, 3: 13, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!