ID: 1145190820_1145190840

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1145190820 1145190840
Species Human (GRCh38) Human (GRCh38)
Location 17:20841552-20841574 17:20841588-20841610
Sequence CCTGGGCACACCCAAGAGGGGAC GGGGGGCGGGCTTCCCTGGGAGG
Strand - +
Off-target summary {0: 6, 1: 4, 2: 2, 3: 13, 4: 151} {0: 6, 1: 4, 2: 4, 3: 45, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!