ID: 1145190824_1145190842

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1145190824 1145190842
Species Human (GRCh38) Human (GRCh38)
Location 17:20841562-20841584 17:20841595-20841617
Sequence CCCAAGAGGGGACCAGGCCGGGG GGGCTTCCCTGGGAGGAAGGTGG
Strand - +
Off-target summary {0: 2, 1: 9, 2: 2, 3: 25, 4: 185} {0: 9, 1: 4, 2: 10, 3: 58, 4: 550}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!