ID: 1145190826_1145190837

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1145190826 1145190837
Species Human (GRCh38) Human (GRCh38)
Location 17:20841563-20841585 17:20841584-20841606
Sequence CCAAGAGGGGACCAGGCCGGGGG GGCCGGGGGGCGGGCTTCCCTGG
Strand - +
Off-target summary {0: 6, 1: 4, 2: 0, 3: 24, 4: 245} {0: 6, 1: 1, 2: 1, 3: 38, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!