ID: 1145190839_1145190849

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1145190839 1145190849
Species Human (GRCh38) Human (GRCh38)
Location 17:20841586-20841608 17:20841612-20841634
Sequence CCGGGGGGCGGGCTTCCCTGGGA AGGTGGGCGGCCCTGCAGGAGGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 1, 3: 28, 4: 232} {0: 3, 1: 3, 2: 1, 3: 34, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!