|
Left Crispr |
Right Crispr |
| Crispr ID |
1145789022 |
1145789025 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:27613309-27613331
|
17:27613328-27613350
|
| Sequence |
CCTTAGCTCAGCTAAAATCCAGG |
CAGGTTCTTGTCTCATGACCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 14, 2: 47, 3: 67, 4: 199} |
{0: 14, 1: 45, 2: 114, 3: 231, 4: 444} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|