|
Left Crispr |
Right Crispr |
| Crispr ID |
1145927657 |
1145927663 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:28659688-28659710
|
17:28659705-28659727
|
| Sequence |
CCGGGCAGAGGTGCTCCTCACTT |
TCACTTCCCAGACGGGGTGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 189, 1: 5103, 2: 10469, 3: 9233, 4: 2471} |
{0: 1160, 1: 988, 2: 3274, 3: 3914, 4: 1434} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|