|
Left Crispr |
Right Crispr |
Crispr ID |
1145927657 |
1145927664 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:28659688-28659710
|
17:28659709-28659731
|
Sequence |
CCGGGCAGAGGTGCTCCTCACTT |
TTCCCAGACGGGGTGGCGGCCGG |
Strand |
- |
+ |
Off-target summary |
{0: 189, 1: 5103, 2: 10469, 3: 9233, 4: 2471} |
{0: 1028, 1: 1721, 2: 3321, 3: 4462, 4: 2532} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|