|
Left Crispr |
Right Crispr |
| Crispr ID |
1145927662 |
1145927668 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:28659703-28659725
|
17:28659716-28659738
|
| Sequence |
CCTCACTTCCCAGACGGGGTGGC |
ACGGGGTGGCGGCCGGGCAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1882, 1: 2591, 2: 6222, 3: 11614, 4: 5578} |
{0: 1237, 1: 2417, 2: 2387, 3: 2586, 4: 2785} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|