|
Left Crispr |
Right Crispr |
Crispr ID |
1145927676 |
1145927686 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:28659743-28659765
|
17:28659786-28659808
|
Sequence |
CCTCATATCCCAGACGGGGCGGC |
ATCCCAGACGATGGGCGGCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 4, 1: 584, 2: 2176, 3: 7760, 4: 9822} |
{0: 1013, 1: 1801, 2: 978, 3: 377, 4: 250} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|