ID: 1146008417_1146008430

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1146008417 1146008430
Species Human (GRCh38) Human (GRCh38)
Location 17:29176831-29176853 17:29176867-29176889
Sequence CCTCACGCCGCCGCGCGGGGAGC GCGTTTCCCCGCGGCTGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 123} {0: 1, 1: 0, 2: 3, 3: 18, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!