ID: 1146008433_1146008444

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1146008433 1146008444
Species Human (GRCh38) Human (GRCh38)
Location 17:29176875-29176897 17:29176920-29176942
Sequence CCGCGGCTGGGCCGGCGCAGCCG GCGATCCCATCTCCCCCGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 299} {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!