ID: 1146184694_1146184702

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1146184694 1146184702
Species Human (GRCh38) Human (GRCh38)
Location 17:30717239-30717261 17:30717276-30717298
Sequence CCAGGAGGCAACCAGCAAGGTGA CAGCACTTGGTGGAAGCTTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 20, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!