ID: 1146237981_1146237984

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1146237981 1146237984
Species Human (GRCh38) Human (GRCh38)
Location 17:31185921-31185943 17:31185959-31185981
Sequence CCTGCCATCTTCTGCAGATAACT TACAGCTCTTGACCTGTTACTGG
Strand - +
Off-target summary {0: 185, 1: 187, 2: 104, 3: 111, 4: 225} {0: 1, 1: 8, 2: 182, 3: 209, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!