|
Left Crispr |
Right Crispr |
| Crispr ID |
1146237981 |
1146237987 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:31185921-31185943
|
17:31185969-31185991
|
| Sequence |
CCTGCCATCTTCTGCAGATAACT |
GACCTGTTACTGGGCTTTGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 185, 1: 187, 2: 104, 3: 111, 4: 225} |
{0: 7, 1: 150, 2: 161, 3: 101, 4: 201} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|