ID: 1146626859_1146626862

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1146626859 1146626862
Species Human (GRCh38) Human (GRCh38)
Location 17:34441606-34441628 17:34441619-34441641
Sequence CCCTAACCACAGGGACAGGGTCT GACAGGGTCTCATTCACCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 201} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!