ID: 1146636970_1146636975

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1146636970 1146636975
Species Human (GRCh38) Human (GRCh38)
Location 17:34513714-34513736 17:34513740-34513762
Sequence CCACTACCAGGAGGTGAGGGCTA TTCTTGTGTATAAATGGTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!