ID: 1146844342_1146844352

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1146844342 1146844352
Species Human (GRCh38) Human (GRCh38)
Location 17:36173842-36173864 17:36173872-36173894
Sequence CCCCCCGCCAGGGTCAAGGGAGC GAGACCTGCCCGGTGTACTCTGG
Strand - +
Off-target summary {0: 11, 1: 0, 2: 3, 3: 24, 4: 425} {0: 14, 1: 2, 2: 1, 3: 19, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!