|
Left Crispr |
Right Crispr |
| Crispr ID |
1146844828 |
1146844839 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:36175932-36175954
|
17:36175968-36175990
|
| Sequence |
CCACAGCTGCCCAAGGGCAGCAG |
AGGCACCATGTGTGTTCAGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 12, 1: 2, 2: 10, 3: 50, 4: 437} |
{0: 1, 1: 13, 2: 2, 3: 13, 4: 135} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|