|
Left Crispr |
Right Crispr |
Crispr ID |
1146850930 |
1146850934 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:36221012-36221034
|
17:36221051-36221073
|
Sequence |
CCCTGCCATCTAGTTCAGATAAC |
GACAGCTCTTAGCCTGTTACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 1, 2: 7, 3: 214, 4: 258} |
{0: 7, 1: 170, 2: 192, 3: 145, 4: 175} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|