ID: 1146850930_1146850934

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1146850930 1146850934
Species Human (GRCh38) Human (GRCh38)
Location 17:36221012-36221034 17:36221051-36221073
Sequence CCCTGCCATCTAGTTCAGATAAC GACAGCTCTTAGCCTGTTACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 214, 4: 258} {0: 7, 1: 170, 2: 192, 3: 145, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!