|
Left Crispr |
Right Crispr |
| Crispr ID |
1146863471 |
1146863482 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:36324473-36324495
|
17:36324508-36324530
|
| Sequence |
CCACTGAACACACATGGTCCCTT |
CTGCTGCCCTTGGGCAGCTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 12, 1: 3, 2: 4, 3: 24, 4: 212} |
{0: 12, 1: 2, 2: 10, 3: 50, 4: 437} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|