|
Left Crispr |
Right Crispr |
| Crispr ID |
1146872557 |
1146872563 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:36385688-36385710
|
17:36385708-36385730
|
| Sequence |
CCCCCCGCCAGGGTCAAGGGAGC |
AGCCTGCCCTGAGACCTGCCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 11, 1: 0, 2: 3, 3: 24, 4: 425} |
{0: 14, 1: 2, 2: 5, 3: 39, 4: 323} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|