ID: 1146872557_1146872573

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1146872557 1146872573
Species Human (GRCh38) Human (GRCh38)
Location 17:36385688-36385710 17:36385730-36385752
Sequence CCCCCCGCCAGGGTCAAGGGAGC GTGTACTCTGGCTGCACCAGGGG
Strand - +
Off-target summary {0: 11, 1: 0, 2: 3, 3: 24, 4: 425} {0: 11, 1: 4, 2: 3, 3: 11, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!