ID: 1146877781_1146877797

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1146877781 1146877797
Species Human (GRCh38) Human (GRCh38)
Location 17:36426916-36426938 17:36426963-36426985
Sequence CCCCCCACACCTCCCCTCGGCCG CCCAGTGCCCAGCACAGGCGTGG
Strand - +
Off-target summary {0: 8, 1: 7, 2: 2, 3: 45, 4: 482} {0: 13, 1: 2, 2: 17, 3: 83, 4: 562}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!