ID: 1146877782_1146877795

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1146877782 1146877795
Species Human (GRCh38) Human (GRCh38)
Location 17:36426917-36426939 17:36426958-36426980
Sequence CCCCCACACCTCCCCTCGGCCGG TCTCTCCCAGTGCCCAGCACAGG
Strand - +
Off-target summary {0: 8, 1: 4, 2: 2, 3: 24, 4: 369} {0: 13, 1: 2, 2: 11, 3: 76, 4: 406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!