|
Left Crispr |
Right Crispr |
Crispr ID |
1146877782 |
1146877797 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:36426917-36426939
|
17:36426963-36426985
|
Sequence |
CCCCCACACCTCCCCTCGGCCGG |
CCCAGTGCCCAGCACAGGCGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 8, 1: 4, 2: 2, 3: 24, 4: 369} |
{0: 13, 1: 2, 2: 17, 3: 83, 4: 562} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|