ID: 1146878163_1146878172

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1146878163 1146878172
Species Human (GRCh38) Human (GRCh38)
Location 17:36429174-36429196 17:36429190-36429212
Sequence CCAAGGGCCCTCTACGTCCAGGT TCCAGGTCGGTTGGGAGGCGGGG
Strand - +
Off-target summary {0: 11, 1: 1, 2: 3, 3: 10, 4: 108} {0: 2, 1: 12, 2: 1, 3: 11, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!