ID: 1146878198_1146878215

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1146878198 1146878215
Species Human (GRCh38) Human (GRCh38)
Location 17:36429292-36429314 17:36429342-36429364
Sequence CCCACAGGGTAGGTGTCTTCCCG AGAACGAGGTGCCCGTGGCGGGG
Strand - +
Off-target summary {0: 14, 1: 1, 2: 0, 3: 6, 4: 91} {0: 14, 1: 0, 2: 0, 3: 4, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!