ID: 1147068599_1147068610

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1147068599 1147068610
Species Human (GRCh38) Human (GRCh38)
Location 17:37934857-37934879 17:37934888-37934910
Sequence CCCAGGAGGACCAGCTGGCCCCC GGCTGAACACCCTGCGGAGCGGG
Strand - +
Off-target summary {0: 12, 1: 2, 2: 5, 3: 46, 4: 359} {0: 13, 1: 1, 2: 0, 3: 7, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!