ID: 1147073688_1147073698

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1147073688 1147073698
Species Human (GRCh38) Human (GRCh38)
Location 17:37978716-37978738 17:37978737-37978759
Sequence CCAAGGGCCCTCTACGTCCAGGT GTCCGTTGGGAGGCGGGGCATGG
Strand - +
Off-target summary {0: 11, 1: 1, 2: 3, 3: 10, 4: 108} {0: 12, 1: 2, 2: 0, 3: 16, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!