ID: 1147075928_1147075939

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1147075928 1147075939
Species Human (GRCh38) Human (GRCh38)
Location 17:37988402-37988424 17:37988437-37988459
Sequence CCACAGCTGCCCAAGGGCAGCAG AAGGGACCATGTGTGTTCAGTGG
Strand - +
Off-target summary {0: 12, 1: 2, 2: 10, 3: 50, 4: 437} {0: 12, 1: 3, 2: 4, 3: 24, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!