ID: 1147077869_1147077875

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1147077869 1147077875
Species Human (GRCh38) Human (GRCh38)
Location 17:38004640-38004662 17:38004657-38004679
Sequence CCCTTGTCCGGGGGAGCCTGCTG CTGCTGCCCTTGGGCAGCTGTGG
Strand - +
Off-target summary {0: 12, 1: 0, 2: 0, 3: 16, 4: 116} {0: 12, 1: 2, 2: 10, 3: 50, 4: 437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!