ID: 1147080122_1147080132

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1147080122 1147080132
Species Human (GRCh38) Human (GRCh38)
Location 17:38014395-38014417 17:38014425-38014447
Sequence CCAGGAGGACCAGCTGGCCCCCT GGCTGAACACCCTGCGGAGCGGG
Strand - +
Off-target summary {0: 12, 1: 2, 2: 6, 3: 24, 4: 328} {0: 13, 1: 1, 2: 0, 3: 7, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!