ID: 1147101132_1147101144

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1147101132 1147101144
Species Human (GRCh38) Human (GRCh38)
Location 17:38182121-38182143 17:38182157-38182179
Sequence CCGCTCCGCAGGGTGTTCAGCCT CAGCTGGTCCTCCTGGGATATGG
Strand - +
Off-target summary {0: 13, 1: 0, 2: 4, 3: 21, 4: 174} {0: 13, 1: 3, 2: 3, 3: 25, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!