ID: 1147720433_1147720444

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1147720433 1147720444
Species Human (GRCh38) Human (GRCh38)
Location 17:42536450-42536472 17:42536486-42536508
Sequence CCGGGCTTGGACACCTACAGCCT GCGGCGCGCGTGCGGGTGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 183} {0: 1, 1: 0, 2: 2, 3: 25, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!