ID: 1147745385_1147745395

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1147745385 1147745395
Species Human (GRCh38) Human (GRCh38)
Location 17:42691541-42691563 17:42691582-42691604
Sequence CCCAGAGCTGACTCTCCAGTTTC TCACTGGTGGTCTCTAGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 179} {0: 1, 1: 0, 2: 1, 3: 7, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!