ID: 1148214547_1148214559

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1148214547 1148214559
Species Human (GRCh38) Human (GRCh38)
Location 17:45827302-45827324 17:45827331-45827353
Sequence CCCTGCACACTGCGCTCCTCCCG CTGGGCCTGTGAACAAGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 183} {0: 1, 1: 0, 2: 3, 3: 26, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!