ID: 1148214548_1148214563

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1148214548 1148214563
Species Human (GRCh38) Human (GRCh38)
Location 17:45827303-45827325 17:45827349-45827371
Sequence CCTGCACACTGCGCTCCTCCCGC CCGGGGTGTTGTGCCATGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 271} {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!