ID: 1148271723_1148271735

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1148271723 1148271735
Species Human (GRCh38) Human (GRCh38)
Location 17:46266907-46266929 17:46266939-46266961
Sequence CCCTACGCTTCCCCGCCGCCCGG CGCGCCGCCGAGGGCCCCGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 24, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!