|
Left Crispr |
Right Crispr |
| Crispr ID |
1148297388 |
1148297395 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:46514483-46514505
|
17:46514531-46514553
|
| Sequence |
CCAACACCAGGTCAGGATCAAGC |
ACAGTTCAACTTTTGGACCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 11, 1: 4, 2: 2, 3: 12, 4: 158} |
{0: 5, 1: 11, 2: 12, 3: 18, 4: 125} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|